Last updated: March 25, 2019
Topic: HealthDrugs
Sample donated:

Angiotensin II ordinance of L-type Ca currents in cardiac musculus is controversial and the underlying signaling events are non wholly understood. Furthermore, the possible function of subsidiary fractional monetary unit composing of the channels in Angiotensin II transition of L-type Ca channels have non yet been explored. In this work we study the function of CaVi??iˆ fractional monetary units and the intracellular signaling responsible for L-type Ca current transition by Angiotensin II. In cardiomyocytes, Angiotensin II exposure induces rapid suppression of L-type current with a magnitude that is correlated with the rate of current inactivation. Semi-quantitative PCR of cardiomyocytes at different yearss of civilization reveal alterations in the CaVi??iˆ subunits look form that are correlated with the rate of current inactivation and with Angiotensin II consequence. Over-expression of single i??iˆ fractional monetary units in heterologic systems reveals that the magnitude of Angiotensin II suppression is dependent on the CaV? fractional monetary unit isoform, with CaVi??1b incorporating channels being more strongly regulated. CaVi??2a incorporating channels were insensitive to transition and this consequence was partly due to the N-terminal palmitoylation sites of this fractional monetary unit. Furthermore, PLC or diacylglycerol lipase suppression prevents Angiotensin II consequence on L-type Ca channels, while PKC suppression with chelerythrine does non, proposing a function of arachidonic acid in this procedure. Finally, we show that in integral cardiomyocytes the magnitude of Ca transients on self-generated crushing cells is modulated by Angiotensin II in a CaVi??iˆ subunit-dependent mode. These informations demonstrate that CaVi??iˆ subunits alter the magnitude of suppression of L-type current by Angiotensin II.

Cardinal Wordss: i?? fractional monetary units ; CaV1.2 ; Angiotensin II ; Neonatal cardiomyocytes ; L-type Ca current ; arachidonic acid.

Introduction

Angiotensin II ( AngII ) is a good known endocrine that plays a important function in physiology and physiopathology by modulating the map of many cells types1. In peculiar, the acute consequence of AngII on L-type Ca currents has been shown to be dependent on the cell type, while in smooth musculus is accepted that AngII bring on activation of L-type Ca current2-4 ; in nerve cells and kidney, the opposing consequence ( suppression of L-type Ca current ) is observed5-7. On the other manus, the consequence of this endocrine in cardiac musculus is still controversial as AngII was reported to bring on an increase8, 9 or a decrease10, 11 of L-type Ca current in bosom cells. Although the ground for this dissension is non known, it is proposed that the experimental attack is relevant12, 13.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

The Angiotensin type I receptor ( AT1 ) is responsible for most of the classical actions associated with AngII. This receptor belongs to the super-family of seven membrane sphere Gq-protein coupled receptor ( GqPCR ) and its activation is linked to phospholipase C ( PLC ) activation and to the production of inositol triphosphate ( IP3 ) and diacylglycerol ( DAG ) , which in bend activates the authoritative and fresh isoforms of protein kinase C ( PKC ) . In parallel to PKC activation, PLC activation induces a lessening in phosphoinositol 4,5-bisphosphate ( PIP2 ) membrane degrees and DAG production induces an addition in arachidonic acid ( AA ) degrees trough the action of DAG lipase ( DAGL ) . Interestingly, while the function of PKC in the AngII-dependent transition of L-type Ca channel is controversial10, 13-15, recent studies show that either PIP2 depletion16 or DAGL-dependent AA production17 are able to modulate L-type Ca channels.

In the bosom, L-type Ca2+-currents are carried by a multi-subunit membrane composite that includes CaV1.2 as the pore-forming fractional monetary unit that co-assembles with the subsidiary CaVi??2i?¤1 and CaVi?? subunits 18, 19. To day of the month, four cistrons that encode the CaVi??1-4 isoforms have been identified and shown to differentially change channel behaviour, including unfastened chance, gating dynamicss activation, and inactivation over L-type Ca2+-current, either in heterologic look systems 20 or in cardiomyocytes 21. While these CaV? fractional monetary unit effects have been extensively studied, less is known about their ability to ticket tune the transition of L-type Ca channels by neurotransmitters and endocrines.

Here we show that the magnitude of AngII suppression of L-type Ca current in neonatal rat cardiomyocytes correlate with the rate of inactivation of the currents and is dependent on DAGL activity, furthermore, we demonstrate that this correlativity is due to a CaV? fractional monetary unit dependance of AngII action. Finally, we show that Ca transients in self-generated whipping cells are modulated by AngII in a CaVi?? fractional monetary unit mode. In decision, we postulate that the consequence of AngII over L-type Ca current is significantly dependent on CaVi?? fractional monetary units and arachidonic acid production.

Methods

Concepts cDNA encoding the angiotonin receptor 1, AT1, was obtained from the University of Missouri-Rolla complementary DNA resource centre. complementary DNA for Ca channel fractional monetary units were kindly provided by Dr. Snutch. The palmitoylation deficient CaV?2a was described previously22.

Cardiomyocytes Isolation Rats were bred in the Animal Breeding Facility from the Facultad Ciencias Qu & A ; iacute ; micas y Farmac & A ; eacute ; uticas, Universidad de Chile ( Santiago, Chile ) . All surveies were done with the blessing of our Institutional Bioethical Committee. Cardiac myocytes were prepared from Black Marias of 1-3 day-old Sprague Dawley rats as described previously23. Briefly, cardiomyocytes were dissociated in a solution of collagenase ( 0.2 mg/ml ) and pancreatin ( 1.2 mg/ml ) . The gathered cells were plated in nitrocellulose-coated glass screen faux pass and cultured in DMEM incorporating 10 % Horse Serum, 5 % FBS, 2 mmolar/L L-glutamine and 50 U/ml penicillin-streptomycin ( Sigma, USA )

Transfection Tissue civilization and transfection of tsA-201 cells was described antecedently in item 24. Briefly, cells were grown at 37 & A ; deg ; C ( 5 % CO2 ) in DMEM ( +5 % FBS, 50 U/ml penicillin-streptomycin ) and plated on glass screen faux pass. Transfection solutions for single civilization dishes contained a mixture of complementary DNA look vectors ( 2 i?­g for each L-type Ca channel fractional monetary unit and 0.2 ?g of a pEGFP marker vector ( Clontech ) ) and were transfected into cells by the Ca phosphate method. Cells were transferred to 30 & A ; deg ; C 24 H after transfection, and recordings were conducted 2-3 yearss subsequently. Cardiomyocytes were transfected the same twenty-four hours of isolation with the same protocol described above with the exclusion that the cells were kept at 37 & A ; deg ; C and experiments were performed 48 hour after transfection.

Electrophysiology Prior to recordings, cells were transferred into an external bath solution of 100 millimeters Na ( millimeter ) : 100 NaCl, 2 CaCl2, 1 MgCl2, 5 glucose, 95 sorbitol and 10 Hepes, pH 7.4, adjusted with Tris. Borosilicate glass pipettes were pulled and polished to 2-4-M? opposition and filled with internal solution contained ( millimeter ) : 108 CsCl, 4 MgCl2, 2 CaCl2 10 EGTA, and 10 HEPES ( pH 7.2 adjusted with CsOH ) . Data were acquired at room temperature utilizing an Axopatch 200B amplifier and pClamp 8 package ( Axon Instruments ) , low pass-filtered at 1 kilohertz, and digitized at 10 kilohertz. Series opposition was compensated to 85 % , leak currents were negligible. In all experiments the perforated-patch constellation was obtained by supplementing the pipette internal solution with Nystatin25 to a concluding concentration of 800 ?g/ml. Ramp protocols ( -120 millivolt to +40 millivolt, 0.8 mV/ms every 15 sec ) were used to supervise the gradual addition of the Na current. After a stable current was achieved ( ?10 min, entree opposition ( Ra ) of 15 ± 8 M? ) bath solution was replaced with a solution contained ( millimeter ) : 20 BaCl2, 1 MgCl2, 10 HEPES, 40 TEA-Cl, 10 glucose, and 65 CsCl ( pH 7.2 adjusted with TEA-OH ) alterations in liquid junction potency were calculated26, and electromotive forces corrected for.

Semi-quantitative PCR. Real-time semi-quantitative PCR was performed utilizing a Strategene Mx300P thermic cycler ( Stratagene, La Jolla, CA ) . Briefly, complementary DNA amplified out of entire RNA from cardiomyocytes in civilization at different yearss. PCR elaboration of the GADPH RNA was used as internal control. PCR reaction was done with Brilliant SYBR Green harmonizing with maker ‘s waies, primers used for qPCR were:

CaVi??1b S: ATGGTCCAGAAGAGCGGCATGTCC ; AS: TTGATGTGCAGGAAGTCCTTGGG

CaVi??2a S: ATGCAGTGCTGCGGGCTGGTAC ; AS: TCCGAACTGCAAATGCAACAGG

CaVi??3 S: ATGTATGACGACTCCTACGTGCC ; AS: TTGACTCCAGAGCCCTGGACTGG

To corroborate elaboration specificity, PCR merchandises were subjected to a liquescent curve plan. Relative RNA sum was calculated with the i?„i?„Ct method and normalized with the sum of GADPH for each sample, measured in triplicates.

Calcium Imaging Plated cardiomyocytes were mounted in a perfusion chamber on the phase of an inverted microscope ( Olympus IX-81, UPLFLN 40XO 40 x/1.3 oil-immersion aim ) . Cells were incubated with Fura-2 AM ( Molecular Probes ; 1 i?­M ) and so superfused for 10-20 min with a solution contained ( millimeter ) : 100 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 90 sorbitol, 5 glucose and 10 Hepes, pH 7.4, adjusted with Tris. AngII was applied by local perfusion system. Fura-2 was alternately excited at 340 and 400 nanometer, and the fluorescence filtered at 510 nanometer was collected and recorded at 5 Hz utilizing a CCD-based imagination system ( Olympus DSU ) running CellR package ( Olympus ) . For every experiment, signals were recorded and the background strength was subtracted, utilizing a same-size part of involvement outside the cells. Consequences are expressed as the ratio between the 340 nanometer and 400 nanometer ( R340/400 ) signals27.

Reagents All reagents were of analytical class and were purchased from Sigma ( USA ) and Merck ( Germany ) .

Statistical Analysis All consequences are presented as agencies ± SEM. Statistical analysis of the information was performed utilizing Statgraphics Plus 5.0 ( Statistical Graphics Corp. , USA ) . Statistically important differences between agencies were assessed with Student ‘s T trials or a one-way ANOVA ( Dunnett ‘s method ) and considered important at P & A ; lt ; 0.05

Consequences

Macroscopic Ba currents were recorded from spread whipping cardiomyocytes utilizing the Mycostatin perforated patch-clamp method to guarantee minimum break of the cytosolic environment. Merely cells that were crushing at the oncoming of experiments were chosen, and to verify proper voltage-control, voltage-dependent Na+ currents were measured before each experiment ( see methods and Figure 1 ) .

We found that L-type currents with fast inactivation dynamicss are more sensitive to AngII, while Ba currents with slow inactivation are hardly inhibited by AngII ( Figure 2A, B ) . This observation was confirmed after plotting the residuary current after a 250 MS pulsation to 10 millivolt ( R250, a step of current inactivation ) against the per centum of current suppression after AngII ( 100 nM ) exposure. Figure 2C shows that these two variables correlate ( R & A ; gt ; 0.8 ) suggesting that the per centum of current suppression by AngII is linked to the inactivation rate of the L-type current.

It has been reported that Ca currents in neonatal cardiomyocytes change throughout the clip of culture28, therefore we examined whether alterations in R250, and accordingly AngII sensitiveness could be attributable to different yearss in civilization. We found that both parametric quantities are correlated with the clip in civilization of the cardiomyocytes after isolation ( Figure 3A, B ) . As the velocity of inactivation ( and hence R250 ) is correlated with the CaVi?? fractional monetary unit expressed, semi-quantitative PCR was performed to observe alterations in CaVi?? fractional monetary unit look. As seen in Figure 3C-E there is a lessening in CaVi??1b look after cells isolation while CaVi??2a increase it expression and CaVi??3 remain changeless.

The ulterior consequences could implicate that alterations in the magnitude of AngII suppression is in fact due to alterations in CaVi?? fractional monetary units. To turn to this point straight, the cardiac signifier of CaV1.2 ( +CaVi??2i?¤1 ) was over-expressed in a stable cell line that over-expresses the AT1 receptor ( HEK-AT1 ) with different CaVi?? fractional monetary units. As seen in Figure 4, when cells over-expressing CaVi??1b were exposed to AngII ( 100 nM ) a fast current suppression ( ~70 % ) was observed ( Figure 4A, B, and Figure 5C ) . Cells showing CaVi??3 showed a lower grade of current suppression ( ~50 % ) ( Figure 4E, F, and Figure 5C ) ; nevertheless, in CaVi??2a showing cells, about no suppression was observed ( Figure 4C, D, and Figure 5C ) , showing that CaVi?? fractional monetary units are powerful regulators of AngII mediated effects on L-type currents.

CaV?2a differs from other CaVi?? fractional monetary units by the being of two cysteine residues near the N-terminus which signifier palmitoylation sites29, and many of the alone belongingss of this fractional monetary unit are dependent on these residues29. Elimination of the putative palmitoylation sites via site-directed mutagenesis22 ( i??2aC ( 3,4 ) S ) resulted in a important sweetening of the AngII mediated transition, albeit non to the degrees observed with other CaV? subtypes ( Figure 5A-C ) . This indicates that the palmitoyl groups of CaVi??2a contribute to the insensitiveness of CaV?2a incorporating L-type channels to AngII.

Following, we decided to research the intracellular signaling tracts responsible for the consequence of AngII on L-type currents. In order to concentrate on cardiomyocytes exhibiting a fast rate of inactivation and hence, with higher L-type current suppression by AngII, merely cardiomyocytes with less of 48 hours ( 0-1 yearss ) in civilization were used ( Figure 3B ) . As shown in Figure 6, PLC suppression with the generic inhibitor U73122 prevented the consequence of AngII on L-type currents. However, in cardiomyocytes treated with the PKC inhibitor chelrytrine, the AngII-dependent L-type current suppression was unaffected. Interestingly, suppression of DAGL was plenty to forestall the consequence of AngII, proposing a function for AA in L-type Ca channel suppression ( Figure 6 ) .

As Ca inflow via L-type Ca2+-current is critical for Ca2+-induced Ca2+-release30, an suppression of L-type Ca2+-currents by AngII should be reflected in a lessening in the magnitude of Ca2+-transients. Consequently, we explored whether CaVi?? fractional monetary units could modulate AngII responses on Ca2+-transients in self-generated whipping cardiomyocytes. All these experiments were done in cardiomyocytes with less of 48 hours in civilization. In control cardiomyocytes, AngII produced a strong suppression of the magnitude of Ca2+-transients as measured with Fura-2 ( Figure 7A, B, G ) . A similar response was observed in cardiomyocytes over-expressing CaVi??1b ( Figure 7C, D, G ) whereas CaVi??2a over-expressing cardiomyocytes showed merely small decrease in the magnitude of Ca transient after exposure to AngII ( Figure 7E, F, G ) .

Discussion

In this study, we show that L-type Ca channels CaVi?? fractional monetary units are critical modulators of L-type current response to AngII. Using primary civilizations of neonatal rat cardiomyocytes we have demonstrated that AngII suppression of L-type currents correlative with the inactivation velocity of the current. At a first glimpse, this observation could connote that suppression may be dependent on the inactivation province of CaV1.2 channels, nevertheless, the experimental protocol was designed to avoid this possibility with short ( 50 MS ) depolarizing pulsations and long inter-pulses intervals ( 15 seconds ) , channels are expected to be in a closed province during AngII application. Therefore, it is more likely that the correlativity with the rate of inactivation may be an epiphenomenon of a different implicit in molecular event, such as channel subunit composing.

Indeed, cardiomyocytes express more than one isoform of CaVi?? fractional monetary units, the chief constituent of the L-type Ca channel multi-protein composite that determines the clip class of inactivation31. As we show here, the look form of CaVi?? fractional monetary units alterations throughout the clip that the cardiomyocytes remain in civilization, hence over-expression of single CaVi?? fractional monetary units in cells that over-express AngII receptor, AT1, and the cardiac signifier of CaV1.2 ( +CaVi??2i?¤1 ) was chosen to show the impact of these fractional monetary units in AngII transition. As suggested from cardiomyocytes informations, the magnitude of suppression is correlated with the type of CaVi?? fractional monetary unit that is expressed. Hence, a more likely account for the ascertained effects is that cells demoing a lower macroscopic rate of inactivation merely express more CaV?2a to give rise to a greater proportion of AngII insensitive channels in a given cell.

This CaV? fractional monetary unit dependence of Ca channel transition is evocative of consequences demoing that CaVi?? subunit subtype regulates the transition of N-type Ca2+-current by Gq-coupled receptors32 and of the suppression of CaV1.3 channels by AA33. In line with these consequences, we show that DAGL activity is necessary for AngII-mediated L-type Ca channel suppression, proposing that AA production is necessary for this consequence and indicating that accessory Ca channel fractional monetary units can function to fine-tune 2nd courier transition of several VDCCs.

Additions in CaVi??2a fractional monetary unit expression34 every bit good as additions in AngII levels35 and alterations in ion channels expression36 are associated with cardiac hypertrophy. In position of our consequences showing that AngII is unable to modulate L-type currents and Ca transients when CaVi??2a is expressed, this could reflect a novel mechanism that may lend to the apprehension of the hurtful effects of AngII.

Beginnings of Funding This work was supported by Fondecyt 11080019 to DV and FONDAP-Fondecyt 15010006 to AS, Chile, and by a CIHR grant to GWZ. GWZ is a Scientist of the AHFMR and a Canada Research Chair.

Figure 1 Na+ and L-type currents in cardiomyocytes. A ) Representative nystatin-perforated whole-cell voltage-dependent Na+ current hints activated by the electromotive force protocol shown in the underside B ) Current-Voltage relation of whole-cell currents with 100 millimeters Na+ external solution ( black hint ) and 20 millimeter Ba2+ ( grey hint ) , utilizing a 180 MS continuance electromotive force incline from -120 to 40 millivolt. C ) Nystatin-perforated whole-cell L-type Ba current hints activated by the electromotive force protocol shown in the underside. All information was obtained from the same cardiomyocyte.

Figure 2 The magnitude of suppression of L-type Ba2+-currents depend on the inactivation velocity of the current. A ) Representative L-type currents, normalized to Imax, from 3 different cardiomyocytes, recorded utilizing the electromotive force protocol shown in the upper portion B ) Time class of L-type Ba2+-current suppression induced by AngII ( 100 nanometer ) obtained from the cardiomyocytes shown in A C ) Plot of the staying current after a pulsation of 250 MSs to 10 millivolt ( R250 ) versus AngII suppression obtained at 60 seconds for single cardiomyocytes. The arrested development line corresponds to a additive tantrum of the informations ( R=0.84, n=16 )

Figure 3 Changes on CaVi?? fractional monetary units look form in cardiomyocytes in civilization A ) R250 of L-type Ba current ( average ± sem ) in cardiomyocytes from different yearss in civilization ( n & A ; gt ; 4 ) . B ) Percent suppression by AngII ( average ± sem ) in cardiomyocytes from different yearss in civilization ( n & A ; gt ; 4 ) . CaVi?? subunits messenger RNA degrees relative to GADPH messenger RNA in cardiomyocytes civilizations at different yearss for CaVi??1b ( C ) , CaVi??2a ( D ) or CaVi??3 ( E ) . n=4. *p & A ; lt ; 0.01, compared with twenty-four hours 1.

Figure 4 L-type Ba2+-current suppression by AngII is i?? subunit dependant. Representative Ba currents before ( black line ) and 60 seconds after ( grey line ) exposure to AngII ( 100 nanometer ) . The currents were recorded from a HEK-AT1 cell line over showing the cardiac signifier of CaV1.2 ( +CaVi??2i?¤1 ) and CaVi??1b ( A ) or CaVi??2b ( C ) or CaVi??3 ( E ) . Time class of the per centum of staying current ( average ± sem ) of L-type Ba2+-current in a HEK-AT1 cell line over-expressing the cardiac signifier of CaV1.2 ( +CaVi??2i?¤1 ) and CaVi??1b ( B ) or CaVi??2a ( D ) or CaVi??3 ( F ) .

Figure 5 Palmitoyl groups of CaVi??2a are partly responsible for the deficiency of response after AngII exposure. Representative currents before ( black line ) and 60 seconds after ( grey line ) exposure to AngII ( 100 nM ) of HEK-AT1 cell line over showing the cardiac signifier of CaV1.2 ( +CaVi??2i?¤1 ) and CaVi??2a ( C3,4S ) ( A ) . Time class of the per centum of current ( average ± sem ) of L-type Ba current in HEK-AT1 cell line over showing the cardiac signifier of CaV1.2 ( +CaVi??2i?¤1 ) and CaVi??2a ( C3,4S ) ( B ) . C ) Summary saloon graph for per centum suppression by AngII for different CaVi?? fractional monetary units. n & A ; gt ; 6. *p & A ; lt ; 0.01 compared with parental HEK cell lines. **p & A ; lt ; 0.01 compared with CaVi??2a.

Figure 6 DAGL suppression prevents AngII consequence over L-type Ca channel. A ) Representative cardiomyocyte Ba currents before ( black line ) and 60 seconds after ( grey line ) exposure to AngII ( 100 nanometer ) and treated with different drugs. B ) Pharmacological scheme used to set up the enzymes involved in the consequence of AngII over L-type Ca channel. C ) Summary saloon graph for per centum suppression by AngII for cardiomyocytes treated with different drugs. N & A ; gt ; 6. *p & A ; lt ; 0.01 compared with cardiomyocytes control.

Figure 7 Calcium transients in rat cardiomyocytes decrease upon AngII intervention. Changes of cytosolic [ Ca2+ ] in self-generated whipping control ( A ) ; CaVi??1b-transfected ( C ) or CaVi??2a-transfected ( E ) cardiomyocytes loaded with Fura-2 ( Ratio 340/380 ) . To find the magnitude of Ca transient, the adjustment to two Gaussians of an all-points histogram ( 5 proceedingss continuance ) was used ( B, D, F ) . The black line represents the best adjustment before AngII, the grey line after AngII G ) Summary saloon graph demoing the per centum of suppression of Ca transient amplitude after AngII ( 100 nM ) exposure. n & A ; gt ; 6, *p & A ; lt ; 0.01.